HTLV-1 Tax plugs and freezes UPF1 helicase leading to nonsense-mediated mRNA decay inhibition
Plasmids
All directed mutagenesis experiments were carried out by a 20-cycle PCR using Phusion polymerase (Thermo Fisher Scientific), a pair of reverse complementary primers (2 µM) and 50 ng of parental plasmid. PCR products were digested with DpnI restriction enzyme and used for XL1blue transformation. The pGEX2T-TaxWT
57 was mutated into pGEX2T-TaxCACA
using 5′-GTTTGGAGACgctGTACAAGGCGACTGGgccCCCATCTCTGGG-3′ oligonucleotide. UPF1 full-length and domains were produced with the pHL UPF1-FL, pHL UPF1-HD, pHL UPF1-CH-HD and pHL UPF1-HD-SQ constructs previously described22. UPF1-HDDEAA
and UPF1-HDR843C
were modified using primers 5′-GCTCCATTTTAATCGcCGcA AGCACCCAGGCCACC-3′ and 5′-CTGTCCTGTGTGtGcGCCAACGAGCACCAAG-3′, respectively. Viral molecular pCMV HTLV-1 WT64 was modified into pCMV HTLV ΔpX by digestion/religation of the two BlpI sites within the Tax/Rex-coding sequence.
Antibodies
The antibodies used were mouse monoclonal antibody against Tax (clone 474, Covalab, 1:1000), mouse monoclonal antibodies against HA (monoclonal clone 7, Sigma-Aldrich, 1:1000), rabbit polyclonal against UPF1 (rabbit polyconal clone A301-902A, Bethyl, 1:20,000), Anti α-His (polyclonal, Abcam ab18184, 1:1000) and anti β-beta actin (monoclonal AC15, Sigma-Aldrich, 1:5000).
Protein expression and purification
GST-Tax proteins were produced from BL21-DE3 bacteria (Novagen) induced with 0.1 mM IPTG at 25 °C during 1 h. After sonication in MTPBS (150 mM NaCl, 12.5 mM Na2HPO4, 2.5 mM KH2PO4, 100 mM EDTA pH 7.3, 0.05% Triton,10% glycerol), the lysate was incubated for 3 h at 4 °C with glutathione magnetic beads (Promega). The beads were washed three times, and Tax was further eluted in three fractions with MTPBS supplemented with 10 mM reduced glutathione at 4 °C. HisUPF1 proteins were produced and purified as previously described22. Briefly, BL21 DE3 bacteria were transformed and induced overnight at 16 °C in 1 l of LB. Lysis was carried by sonication in 1.5× phosphate-buffered saline (PBS), 0.1% NP40, 20 mM imidazole, 1 mM magnesium acetate and 10% glycerol with lysozyme. Soluble lysate was applied to 1 ml of NiNTA beads (Macherey-Nagel) for 3 h at 4 °C. The NiNTA resin was washed three times, and UPF1 proteins were eluted in three fractions with lysis buffer supplemented with 150 mM imidazole. The Tax/UPF1-HD complex was purified with a NGS HPLC system (Bio-Rad) after co-lysis of 200 ml of HisUPF1-HD and 1 l of Tax-expressing bacteria pellets. Lysis was performed in MTPBS with lysosyme and 5 mM imidazole. The co-lysate was first applied to a HisTrap column. The eluate (250 mM Imidazole) was dialysed in buffer PBS (1 × PBS, 10 % glycerol, 4 µM MgCl2, 6 µM ZnCl2, 0.1% NP40) and further purified with a GST-Trap column. The Tax/UPF1-HD complex was finally eluted with PBS buffer supplemented with 10 mM reduced glutathione and dialysed against PBS buffer.
RNA and protein co-precipitation
The RNA co-precipitation and GST pulldown were performed as described previously20,22,41,65. Briefly, in the RNA co-precipitation assay, proteins or preformed protein complex (2 µg) were mixed with 70 pmoles of 3′ end-biotinylated ssRNA (CGUCCAUCUGGUCAUCUAGUGAUAUCAUCG[BtnTg]) in binding buffer (20 mM HEPES pH 7.5, 150 mM potassium acetate, 2 mM magnesium acetate, 1 mM dithiothreitol (DTT), 6.3% (v/v) glycerol and 0.1% (w/v) NP-40). The reactions were performed in a final volume of 30 µl and incubated for 20 min at 30 °C. Then, 5 µl of pre-coated streptavidin-coupled magnetic beads (Dynabeads, Life Technologies) were added before further incubation for 1 h at 4 °C. Unless indicated otherwise, the beads were washed with binding buffer containing 200 mM NaCl. Proteins were eluted by addition of 7.5 µl of SDS loading buffer directly to the beads. The various fractions were subsequently analysed by 12% SDS-PAGE. For precipitation of protein complexes by GST-bait protein, the magnetic beads were replaced with 12 µl of GST resin (50% slurry, Promega). The resin was washed three times with 500 µl of binding buffer containing 200 mM NaCl and eluted with SDS loading buffer. Eluates were separated by 10% SDS-PAGE and visualised by coomassie staining.
ATP binding
Equilibrated amounts of proteins were applied to a nitrocellulose membrane with a slotblot apparatus. The membrane was soaked in blocking buffer (20 mM HEPES pH 7.0, 50 mM potassium acetate, 2.5 mM magnesium acetate, 2 mM DTT, 3% BSA (w/v), 10% (v/v) glycerol) and incubated on a rocking platform for 1 h at room temperature. The blocking buffer was then replaced with binding buffer (20 mM HEPES pH 7.0, 50 mM potassium acetate, 2.5 mM magnesium acetate, 2 mM DTT, 1.5% (w/v) BSA, 10% (v/v) glycerol) supplemented with 30 mCi of [α−32P]-ATP (Perkin Elmer) before further incubation for 20 min at room temperature. The membrane was washed twice with blocking buffer before being dried and analysed by phosphorimaging.
ATP hydrolysis
ATPase assays were carried out as described in ref. 22. Briefly, 10 pmol of UPF1 protein and UPF1/Tax preformed complex were incubated at 30 °C in a 10-µl reaction mixture containing 20 mM MES pH 6.0, 100 mM potassium acetate, 1 mM DTT, 0.1 mM EDTA, 1 mM magnesium acetate, 1 mM zinc sulphate, 5% (v/v) glycerol, 2 µCi of [α-32P]-ATP (800 Ci.mmol−1, Perkin Elmer), 25 mM cold ATP and 20 µg.ml−1 tRNA. At the indicated times, 2 µl reaction aliquots were withdrawn and quenched with 10 mM EDTA and 0.5% (v/v) SDS. Samples were analysed by phosphorimaging after TLC on polyethyleneimine cellulose plates (Merck) with 0.35 M potassium phosphate (pH 7.5) as migration buffer.
Electrophoretic mobility shift assay
The EMSA was performed as described in Fiorini et al22. Samples were prepared by mixing a radiolabelled 30-mer oligoribonucleotide (1 nM; CGUCCAUCUGGUCAUCUAGUGAUAUCAUCG) with UPF1 protein (0, 1, 3, 5, 10 nM) with or without TaxCACA
(300 nM) in a buffer containing 20 mM MES pH 6.0, 150 mM potassium acetate, 2 mM DTT, 0.2 µg.µl−1 BSA and 6% (v/v) glycerol. The samples were incubated at 30 °C for 20 min before being resolved by native 6.5% polyacrylamide (19:1) gel electrophoresis and analysed by phosphorimaging.
RNA decay assays and qRT-PCR/RT-PCR
RNA decay assays were performed to assess the stability of mRNA expressed from a β-globin reporter minigene that was either WT (Gl-WT) or with a PTC in the second exon (Gl-PTC)41. For this procedure, 0.5 µg of Gl-PTC or 0.05 µg of Gl-WT constructs were co-transfected as indicated with 0.5 µg of renilla-expressing vector in 0.7 × 106 HeLa cells with jetprime reagent (polyplus transfection). Additional plasmids were co-transfected as indicated in the figures. The medium was changed after 12 h, and cells were further cultivated for 24 additional hours. Then, following RNA decay, the cells were cultivated for 0, 1, 3 or 4 h under DRB treatment (100 µg.ml−1) to block transcription. Total mRNAs were extracted using the Macherey-Nagel RNA easy extraction kit and quantified by qRT-PCR using the QuantiTect SYBR Green qRT-PCR kit (Qiagen) and appropriate primers:
GLOBIN (Globin 3′ forward 5′-TTGGGGATCTGTCCACTCC-3′, Globin 3′ reverse 5′-CACACCAGCCACCACTTTC-3′, Globin full-length forward 5′-GATGAAGTTGGTGGTGAGGC-3′, Globin full-length reverse 5′-AGTGATACTTGTGGGCCAGG-3′), GADD45α (forward 5′-ACGAGGACGACGACAGAGAT-3′, reverse 5′-GCAGGATCCTTCCATTGAGA-3′), MAP3K14 (forward 5′-TCAGTGCAGAACCAGGTCAG-3′, reverse (5′-GGGGACTGAGAACCACTTCA-3′) and SMG5 (forward (5′-ACAGAATGGGATGCCAGGAA-3′, reverse 5′-TCAACACTCCAAAAGCCAGC-3′). Normalisation was carried out with respect to renilla mRNA (renilla forward primer 5′-CTAACCTCGCCCTTCTCCTT-3′, renilla reverse 5′-TCGTCCATGCTGAGAGTGTC-3′). The values represented in the graphs correspond to the mean of at least three biological replicates, and the error bars correspond to the SD. Half-lives were calculated for each replicate, and P values were calculated by performing a Student’s t-test (unpaired, two-tailed) ns: P > 0.05; *P < 0.05; **P < 0.01.
RNA immunoprecipitation
For UPF1 RIP, ~2 × 106 HeLa cells were transfected as described in the figures, harvested and resuspended in lysis buffer (50 mM Tris–Cl, pH 7.5, 1% NP-40, 0.5% sodium deoxycholate, 0.05% SDS, 1 mM EDTA, 150 mM NaCl, protease inhibitor (Roche) and RNAsin (Promega)). Extracts obtained after centrifugation at 12,000g for 15 min were incubated with primary antibody overnight at 4 °C. Protein A and G magnetic beads (dynabeads, Life Technology; 5 µl each) were mixed and coated with PBS + 5% BSA, supplemented with tRNA and RNasin overnight. After re-equilibration in lysis buffer (supplemented with tRNA), the beads were added to the lysate for 2 h at 4 °C before extensive washing in lysis buffer. The beads were resuspended in elution buffer (50 mM Tris–HCl, pH 7.0. 1 mM EDTA, 10 mM DTT and 1% SDS).
For RIP Tax, we followed the protocol described by Niranjanakumari et al.66 to perform reversible crosslinking combined with RIP. For each RIP condition, ~2 × 106 HeLa cells were transfected as described in the figures, harvested and fixed with 0.05% formaldehyde for 20 min at room temperature. Then, 0.25 M glycine was added for 5 min before PBS washing. The cell pellet was resuspended in 2 ml of lysis buffer, and the lysate was sonicated (bioruptor, diagenode). The immunoprecipitation steps were carried out as described for UPF1 RIP, except that extensive washings were performed with 50 mM Tris–Cl, pH 7.5, 1% NP-40, 0.5% sodium deoxycholate, 0.05% SDS, 1 mM EDTA, 500 mM NaCl and 1 M urea. The beads were resuspended in elution buffer and incubated at 70 °C for 45 min for reverse-crosslinking. In the case of the double-RIP experiment, ~9 × 106 HeLa cells were transfected with 10 µg of Tax and 15 µg of the HA-UPF1 expression plasmids41, as well as 10 µg of Gl-PTC construct. The cells were treated using similar conditions as described for Tax RIP. First, the HA tag was immunoprecipitated. Elution was carried out at 4 °C in 10 µl of 50 mM Tris HCl, 1 mM EDTA, RNAsin and 20 mM DTT for 1 h, plus one additional hour in 150 µl of 50 mM Tris HCl, 1 mM EDTA complemented with 100 µg.ml−1 HA elution peptide. Finally, the elution volume was increased to 500 µl (50 mM Tris–Cl, pH 7.5, 1% NP-40, 0.5% sodium deoxycholate, 0.05% SDS, 1 mM EDTA, 150 mM NaCl, protease inhibitor (Roche) and RNAsin), and Tax immunoprecipitation was performed. After extensive washing, the beads were resuspended in elution buffer and incubated at 70 °C for 45 min for reverse-crosslinking.
For all RIP, RIP and double-RIP experiments, the precipitated RNA was further extracted with RNAzolRT reagent (MRC) and subjected to qRT-PCR.
DNA and siRNA transfection
DNA and short interfering RNA (siRNA) co-transfection in HeLa cells was carried out using jetprime® reagent according to the manufacturer’s instructions (Polyplus transfection SA). The siCtrl (MISSION siRNA Universal negative control, SIGMA) and siUPF1 (5′-GAUGCAGUUCCGCUCCAUUGAUGCAGUUCCGCUCCAUU-3′) were used at a final concentration of 10 nM. Twenty-four hours later, the cells were washed with PBS and reincubated in fresh medium for 48 h before harvest.
Biolayer interferometry
Biolayer interferometry experiments were carried out using a BLItz apparatus (ForteBio). The affinity of UPF1 HD for its substrate was analysed with a SAX biosensor. First, the absence of aspecific binding of each of the analysed proteins on the biosensor was verified. Next, a 90 µg.ml−1 solution of random 30-mer DNA oligonucleotides with Biotin TEG at its 5′ extremity was immobilised on the streptavidin SAX biosensor in 1 × PBS buffer. The biosensor was further equilibrated in 20 mM HEPES pH 7.5, 150 mM potassium acetate, 2 mM magnesium acetate, 1 mM DTT, 6.3% (v/v) glycerol and 0.1% (w/v) NP-40. For the association curve, the ligand proteins were diluted at the indicated concentrations in 20 mM HEPES pH 7.5, 150 mM potassium acetate, 2 mM magnesium acetate, 1 mM DTT, 6.3% (v/v) glycerol and 0.1% (w/v) NP-40 and further incubated with the SAX biosensor. The following dissociation curve was obtained by incubating the biosensor in 20 mM HEPES pH 7.5, 150 mM potassium acetate, 2 mM magnesium acetate, 1 mM DTT, 6.3% (v/v) glycerol and 0.1% (w/v) NP-40) without ligand. The biosensor was regenerated with buffer containing 150 mM NaCl, 1.25 mM EDTA and 0.125% SDS. The kon, koff and KD were calculated using the manufacturer’s software (BLItz Pro 1.2). Each experiment was conducted at least in triplicate.
The affinity of UPF1-HD WT and mutant proteins for GST-Tax was analysed with an AR2G sensor (ForteBio). First, GST-Tax was covalently bound to the biosensor following the manufacturer’s procedure: the biosensor was activated for 300 s with 20 mM EDC, 10 mM NHS and 10 mM sodium acetate pH 5. Next, 20 nM of Tax diluted in 100 mM sodium acetate pH 4 were linked for 500 s before quenching with 1 M ethanolamine pH 8.5. The baseline was acquired after 120 s of incubation in the manufacturer’s running buffer (300 mM NaCl, 20 mM phosphate, 0.02% Tween 20, 0.1% albumin, 0.05% ProClin300) before 250 s of incubation with UPF1 His-HD protein diluted in the running buffer. Finally, the dissociation step was acquired after 60 s of incubation of the sensor with running buffer without protein.
Experiment with magnetic tweezers
The DNA hairpin used for single-molecule experiments was performed as described by Fiorini et al.33. The 1.2-kbp DNA substrate is a 1239-bp hairpin with a 4-nt loop, a 76-nt 5′-biotinylated ssDNA tail and a 146 bp 3′-digoxigenin-labelled dsDNA (sequence available in supplementary methods). We used a PicoTwist magnetic tweezers instrument (www.picotwist.com) to manipulate individual DNA. The DNA hairpins were attached by the 5′-biotinylated extremity to streptavidin-coated magnetic beads (Dynabeads MyOne streptavidin T1, Life Technology) and by a 3′-digoxigenin-modified extremity to an anti-Dig-coated glass surface. The glass coverslip had been previously treated with anti-digoxigenin antibody (Roche) and passivated with 1 × PBS Buffer (1 × PBS pH 7.5, 0.2% pluronic surfactant, 5 mM EDTA, 10 mM sodium azide and 0.2% BSA (Sigma-Aldrich)). Experiments were conducted at 37 °C in helicase buffer (20 mM Tris-HCl pH 7.5, 75 mM potassium acetate, 3 mM magnesium chloride, 2% BSA, 0.5 mM DTT and 2 mM ATP). The indicated UPF1 concentration was the lowest possible concentration to observe helicase activity under single-molecule conditions (between 1 and 20 nM depending on the protein batch). TaxCACA
was used at a 5 nM final concentration.
Data availability
All relevant data are available from the authors.
Comments